For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 125 bp
Wild Type = 110 bp
>chr15:9007298+9007407 110bp TCTAAGACCCGCTGTTCTGC GCTCGGCCTTTTCCTTAGTT |
Sequence
Wt Sequence (deletions in lower case):
TTGGTTAGACAAGCCACATGATCTAAGAAAACACTAATTTGGCAAAAAGCTAGGCAAAAAGTGagcagcgggcaattgacggactgcactgactttggtctctgaaaattcagttgtgatcattttttttctaaagcattatttaaaaatagggacaaaggagcatttcattaacaatttattggtcttttcattatgctctctcaaggaccccccatgagatcttctgaacaggttctaagacccgctgttctgcagccgtctcaaactcagagttgtcagaaagcaggcacaacatttgggcccggtgcattgaaatcctacaaaactaaggaaaaggccgagcacgaggtaagaaaaatccccggtgacagaagcaacagtgaaatgttcttggtaatcttaggaaatgagagagtgctccccggaccagatttcgtagttgctgtcactcccaagtggaaaaactgtgcggcaggcagtgggaactcatgagtgtagtaggactgccagaatgatgacagtataaaacgctgggggaggggggcagtgagatgggcacgggcggaacctgtagtcaaataatgggtagggtgttctgcatccccagctgtccaacatcagAGTGGAGCAAGCTTTGTCAGCTTAGTTCACACTAGACACATCTTCATGGATAACAGCAGCAA
This mutation is a 561 bp deletion beginning at Chromosome 15 position 9,007,125 bp and ending after 9,007,685 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 66045 | TCT AAG ACC CGC TGT TCT GC | Wild type Forward | A | |||
| 66046 | GCT CGG CCT TTT CCT TAG TT | Wild type Reverse | A | |||
| 66047 | TTG GTT AGA CAA GCC ACA TGA | Mutant Forward | A | |||
| 66048 | TTG CTG CTG TTA TCC ATG AAG | Mutant Reverse | A | |||
| 66049 | Fluorophore-1 | CAG AGT TGT CAG AAA GCA GGC | Quencher-1 | WT Probe | ||
| 66050 | Fluorophore-2 | AGT GAG TGG AGC AAG CTT TGT CA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 66045 | 0.40 uM |
| 66046 | 0.40 uM |
| 66047 | 0.40 uM |
| 66048 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.