Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
Mutant= 120 bp
Wild Type = 128 bp
>chr17:80274675-80274802 128bp TCCCAAGTAACACTTTCCTTTC TCCTCATCTAGCCTCAAAGTG
Wt Sequence (deletions in lower case):
TGTCATTTCCCAAGACAGAAACTAACAGTTCACTATAAGATGAAACCAGCAACTgaagggcagggtcccaagtcgttggctctttgattaaatgcttacacccttgcttaatttttctctgaaataagtagacattaacatccaatattttaaaatgtccccttccctagaagaggcacctctggggaggaggaagacagcgagccccagtgtggcgaggagcagggctggccagctggacaagagcctatctttcttcctgactgcagtccttgggaatatataggcccagaagaagtggagcctcctgtgccagaatgtgcagtctcacccttggcagtgcagaaactttccaggtgatcactttatcacttacagaagtctcttctctgtggatgccctatcatgacagtgcccgtagggcccaatatgctgacaactcgatcttttaaaatggagggattattattatctgggatgctttttccaaatacagaatgtagctgtccacagttgtaactccatatttgtatttaagtgactctcacgtcagtgatgtgaagacttttacacagcatctttgtcatgttttgccctcggcaggtacggcttccacactgagcactgtcagctggccctgaggatctgtgatggagacttaggggcggcactagagcatcttctccgccagtgtttctcagagacgtttggagagaggatggcgctctctgaggcagctgtttatgtgagcttgaatgagtgtgtggagcagagacaggaagagacgcttgctctcaagtccatctgcggagaaaaattcatagaaagaattcagaacagagtctggaccattggattggaactggattatttgacaaacaaattctgcaagtctaagcaaaaggaaagtagcaaaaatgtacgggacacttcgcctgaaacctgtaaattttacctcaaaggaaattgtaaatttggatcaaaatgcaaattcaaacatgaagtgcccccacatcaaatgattgggagagcagaaagaaacgtaaatgaccctcaccttgacgctgatgacgacacaacctttatgtatgagcttcagattcgcttttctaaagaccacaaatacccctaccaagctcccctggtggcattttattccaccaatgagaacctacctctggcttgtcgtttacatatttctgagttcctttatggcaaggccttggaatttgcaaaaacttcagaacctgttgtctattctctgatcacccttttagaggaagagtcagagattgtcaagttactaacacacactcaacataagtatagcgttcctcctgtgaacgtccctccagtaccttccgagaccagaataagtaaacctgcctaccgcaaaccagtggtcccaagtaacactttcctttctaatcaaatgctagaaggtacgtacagtattgctcctaggGACAGGATGGGATCAGCAGTCAGAGTAGTGAGTTTAAAAGTAAAACACTTTGAGGCTAGATGAGGA
This mutation is a 1411 bp deletion beginning at Chromosome 17 position 80,274,741 bp and ending after 80,276,151 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 66027 | TCC TCA TCT AGC CTC AAA GTG | Common | A | |||
| 66028 | TCC CAA GTA ACA CTT TCC TTT C | Wild type Forward | A | |||
| 66029 | TGT CAT TTC CCA AGA CAG AAA C | Mutant Forward | A | |||
| 66030 | Fluorophore-1 | ATG CTA GAA GGT ACG TAC AGT ATT GCT | Quencher-1 | WT Probe | ||
| 66031 | Fluorophore-2 | AAC CAG CAA CTG ACA GGA TGG | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 66027 | 0.40 uM |
| 66028 | 0.40 uM |
| 66029 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.