For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 77 bp
Wild Type = 72 bp
>chr15:79643657-79643728 72bp TGAAATAATGCAGTTGAGTAGGAA AGGCTAATGCGGAAGAGGAC |
Sequence
Wt Sequence (deletions in lower case):
ACACAATGGGACCATGTCAGTGATGGGTGGCAGAGGCCCTTACCACCagcgggtagaagagaggtgcttagctacacatgttgctccaggcttgcaggtgccaataaggaaaatgctctattccctgaccctcgccctcttccctggttacatcaatttcttatgcccacttttcctcctcctcctggtttttgaaggcaattgaagactatgagttggagaagaagtctttaagagagaaaactcacggcagcccaggagacaaaggcaaaaatattttctcagcctaaaaacgtgtttttgtggggtttgattttatttttaattttctttagtttgcatacttcttagctgtttctgttttgtggtgctaggcatggatcccatggccttgcacacaccaaccacatgccctgtcactgaggtggaccccggtggggtttttctgtttgtttgtttgtttgtttgcttggttttttcagtttttgaaataatgcagttgagtaggaatccagagctctaccccagGATAGGTTTTGTCCTCTTCCGCATTAGCCT
This mutation is a 481 bp deletion beginning at Chromosome 15 position 79,643,687 bp and ending after 79,644,167 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 66014 | AGG CTA ATG CGG AAG AGG AC | Common | A | |||
| 66015 | TGA AAT AAT GCA GTT GAG TAG GAA | Wild type Forward | A | |||
| 66016 | ACA CAA TGG GAC CAT GTC AG | Mutant Forward | A | |||
| 66017 | Fluorophore-1 | CCA GAG CTC TAC CCC AGG A | Quencher-1 | WT Probe | ||
| 66018 | Fluorophore-2 | AGG CCC TTA CCA CCG ATA GGT T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 66014 | 0.40 uM |
| 66015 | 0.40 uM |
| 66016 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.