For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 94 bp
Wild Type = 109 bp
>chr9:48393920+48394028 109bp CATTCTGTGTCTCCATGCACT CCATCTAGAATTTCAGGCCACT
Sequence
Wt Sequence (deletions in lower case):
CATTCTGTGTCTCCATGCACTGCCTTGCACACAAACTCTGGgtccctgcctactatggaccaagaaatgaataaaagaaacttactaagtggcctgaaattctagatgggaaagttgtattatcactgagaactcacagaaggactagccaatctgggatctggagtgttgtctgagttgaagccactgtatattaatttctgtgcttgtctctttaaggtcaaatatagctgtggagattatggaaaaatccaatgcgattagtgtctccaaatgcaacagtaagtggtcctgtgctggtgggggatgagttacactgaacctatttaaaggtccttccctttctgttggacttggtcactgtctcagttcttgtaaggcgggccaaggcacaaagtccatgaatgagcaaatgagtgtgatcactagaactttggttaggtgctttagcagccacacctgtcagcaatctgctcatcaggctgaaggtcacctgtccatctaaGTCTTTACATAGTTCCTCATCTTCCCCTACCCTCTTTACATCCTTCCTTGGGA
This mutation is a 464 bp deletion beginning at Chromosome 9 position 48,393,961 bp and ending after 48,394,424 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 66009 | CAT TCT GTG TCT CCA TGC ACT | Common | A | |||
| 66010 | CCA TCT AGA ATT TCA GGC CAC T | Wild type Reverse | A | |||
| 66011 | TCC CAA GGA AGG ATG TAA AGA G | Mutant Reverse | A | |||
| 66012 | Fluorophore-1 | CCT GCC TAC TAT GGA CCA AGA A | Quencher-1 | WT Probe | ||
| 66013 | Fluorophore-2 | CAC ACA AAC TCT GGG TCT TTA CAT AGT T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 66009 | 0.40 uM |
| 66010 | 0.40 uM |
| 66011 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.