Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
Mutant= 125 bp
Wild Type = 127 bp
>chr12:112774229+112774355 127bp CTTCTCAGCACCTCAACACG GACACCACTACTCAGAATCTCCAG |
Wt Sequence (deletions in lower case):
CTTCTCAGCACCTCAACACGGAAACAGGGACAGTGTTCCCCACGTGTCCCcgacagggttttagatgtgcgagcctgtggtttttcactgtgttttacatagcctggagattctgagtagtggtgtcgtcggtcgtcagtgacggcaacaccaaccgagcacgcagccagggactaaatacacttatgttagagtggagtatttgggacaaggtgacctaatgtatgtacgttgctcctaaccttgggacgttcctcctttccagtccattcccagctatgagaaggtttttaggcttgcgtttcaagaagtcgccgtggaacaggctcctgaagacgtttgctccctggaccatttcttggaaagaagcaatgaaggggctgcatctgtgccgagactctggtaatgaacttagctcggaactgcgcCGTGGCGCTGTGGCTGCGTTTCTTGTGTGCTAATGTGGTTTCACAAAGCTTTTTTGGTTGTTCCTAGAGGGTGCA
This mutation is a 378 bp deletion beginning at Chromosome 12 position 112,774,279 bp and ending after 112,774,656 bp (GRCm39/mm39).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 64069 | TGC ACC CTC TAG GAA CAA CC | Mutant Reverse | A | |||
| 65984 | CTT CTC AGC ACC TCA ACA CG | Common | A | |||
| 65985 | GAC ACC ACT ACT CAG AAT CTC CAG | Wild type Reverse | A | |||
| 65986 | Fluorophore-1 | CCG ACA GGG TTT TAG ATG TGC | Quencher-1 | WT Probe | ||
| 65987 | Fluorophore-2 | TGG CTG CGT TTC TTG TGT GC | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 64069 | 0.40 uM |
| 65984 | 0.40 uM |
| 65985 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.