For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 120 bp
Wild Type = 121 bp
>chr6:82908212-82908332 121bp GCCTGCTTCCTTCCATCTC GCATCCCTAGAATAGCCCTAGA |
Sequence
Wt Sequence (deletions in lower case):
GCCTGCTTCCTTCCATCTCTTTGGCTGCAGCACATCTTCTAGGCAGTTACAGACtccagaatttgagaggaaaggtctttgtgcagcctcatggtattttctagggctattctagggatgctttcatgggggaagtgtgggggacaggtctgggcggcaaagaggaataaagcagagaaagaaatgagtgggtggaggaggcaggggtaaggcagctagctgaatacggagatgggagtggggtgagcggggtacgaatggagatgggcttttccttcatttgatcttatgtttaattctcactgtgaaccttctccataaaccctaaactacctgcccccctccccttctggtctgtaggatgtgtccagtttccagcaggttgaaagacttgagagtggccgggggaaatgtccttttgagccagctcaacggtcagcagctgtaatggctggtgagtggggagagccaagagtcggtgattcttgctctaacgacctccttccccacccctgctactccaatttctgtgtctcttcttcccttgggatgtcaactgcactcatgtctccattcagcctttcctggtgtccccgcgtgactgtgacTACCAACATGTCTCCATAGGATGATATTTTCCCCCTGGCTCCTTTTTAGGGACTGTAGCCTCTGCA
This mutation is a 554 bp deletion beginning at Chromosome 6 position 82,907,725 bp and ending after 82,908,278 bp (GRCm39/mm39).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65979 | GCC TGC TTC CTT CCA TCT C | Common | A | |||
| 65980 | GCA TCC CTA GAA TAG CCC TAG A | Wild type Reverse | A | |||
| 65981 | TGC AGA GGC TAC AGT CCC TAA | Mutant Reverse | A | |||
| 65982 | Fluorophore-1 | TCC AGA ATT TGA GAG GAA AGG TC | Quencher-1 | WT Probe | ||
| 65983 | Fluorophore-2 | AGG CAG TTA CAG ACT ACC AAC ATG TCT C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 65979 | 0.40 uM |
| 65980 | 0.40 uM |
| 65981 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.