For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 129 bp
Wild Type = 137 bp
>chr7:97966176+97966312 137bp AACCCATTCTTGTCTTTACCC CACTCAGCACCAAAATGGAC |
Sequence
Wt Sequence (deletions in lower case):
AACCCATTCTTGTCTTTACCCTTAATGTAGATGCTATTACTGATTCCTCCTATATTTTAATCATTgaaatattttttccagggttgtttatctggggacaggatgctggttcttttggtccattttggtgctgagtgcagctgggatcatggttgcctacactaccttgcttttggtgagtgatgcttctcatttttttcctccttaaacagcctcatgggctactccttcctgtgctagtgtatctatctgtagtccttgatattagtagagttggaatttacaccatctccttcaatttcatgcacaagGAGTGGCTGAAGGAGATGTATGCTATTTAGAGTATGAGTCTAATAAAGCTGACCCTTGAGCAGG
This mutation is a 246 bp deletion beginning at Chromosome 7 position 97,966,241 bp and ending after 97,966,486 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65952 | AAC CCA TTC TTG TCT TTA CCC | Common | A | |||
| 65953 | CAC TCA GCA CCA AAA TGG AC | Wild type Reverse | A | |||
| 65954 | CCT GCT CAA GGG TCA GCT T | Mutant Reverse | A | |||
| 65955 | Fluorophore-1 | TTT CCA GGG TTG TTT ATC TGG | Quencher-1 | WT Probe | ||
| 65956 | Fluorophore-2 | TTA ATC ATT GAG TGG CTG AAG GAG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 65952 | 0.40 uM |
| 65953 | 0.40 uM |
| 65954 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.