Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
Mutant= 124 bp
Wild Type = 104 bp
>chr15:88811151-88811254 104bp GACTATATTTTCTGGAGTGCTGGT TAAAGGTGTGCGCCTCCAC |
Large deletion: Mutant sequence with junction in uppercase
gtcctcatgacatacttcagcagccagccagccaggactgtgggactgaaaggaagtcagATaggtacttttaaaggttcgtcagaaataggtttgccctgggcggtggaggcgcacaccttta
This mutation is a 4434 bp deletion beginning at Chromosome 15 position 88,811,214 bp and ending after 88,815,647 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65217 | GAC TAT ATT TTC TGG AGT GCT GGT | Wild type Forward | A | |||
| 65218 | TAA AGG TGT GCG CCT CCA C | Common | A | |||
| 65219 | GTC CTC ATG ACA TAC TTC AGC A | Mutant Forward | A | |||
| 65220 | Fluorophore-1 | TTA ATT ACC AGG GTG ATA GGT ACT TTT A | Quencher-1 | WT Probe | ||
| 65951 | Fluorophore-2 | ACT GTG GGA CTG AAA GGA AGT CAG | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 65217 | 0.40 uM |
| 65218 | 0.40 uM |
| 65219 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.