For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr6:28431510+28431606 97bp AGATGCTGAGGTGTGTGCTG TGAACGAAGTTGCAAGGTAGG
Mutant= 92 bp
Wild Type = 97 bp
Sequence
Wt Sequence: aaggtggaggagggagaagtacagggaaagccagcaattagcacagCcaaggggctggggcggagctaagaaggggctggggcggagctaagaagggtctggggcggagctaaaaagctgcttgcataccttctcctc
Mut Sequence: aaggtggaggagggagaagtacagggaaagccagcaattagcacagCCctagacatactttctccttccccggcatgtgtggcgagataaga
A 263 bp deletion beginning at Chromosome 6 position 28,431,420 bp and ending after 28431682 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65461 | AAG GTG GAG GAG GGA GAA GT | Mutant Forward | A | |||
| 65462 | TCT TAT CTC GCC ACA CAT GC | Mutant Reverse | A | |||
| 65464 | Fluorophore-1 | CAA TTA GCA CAG CCC TAG ACA TAC T | Quencher-1 | MUT Probe | ||
| 65940 | AGA TGC TGA GGT GTG TGC TG | Wild type Forward | A | |||
| 65941 | TGA ACG AAG TTG CAA GGT AGG | Wild type Reverse | A | |||
| 65942 | Fluorophore-2 | TCT GAG CGT TTG ACC CAG AT | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 65461 | 0.40 uM |
| 65462 | 0.40 uM |
| 65940 | 0.40 uM |
| 65941 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.