Protocol 45577: Probe Assay - Ubxn11<em1(IMPC)J> Alt 1
Version 2.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr4:133840170+133840285 116bp CAGGCTCACACTCACACCTG CTTACTCTGGTGCTGCTGGA

Mutant=  75 bp

Wild Type = 116 bp

Sequence

Wt Sequence: caggctcacactcacacctggtctccaccttctcaccctgagtctcactgcttcagGAGCGGAAGATCCTGGACCTGGAGGATTTGGTACAGACCCTCCAGCAGCACCAGAgtaag

Mut Sequence: gcatggcccgCATctatcccaagtcctcgctgtgggtttgtggctgggccctgctctcctatctggaacctctct

A 1340 bp deletion beginning at Chromosome 4 position 134,112,348 bp and ending after 134,113,687 bp (GRCm38/mm10). There is a single bp (A) insertion at the deletion site.

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
65934 CAG GCT CAC ACT CAC ACC TG Wild type Forward A
65935 CTT ACT CTG GTG CTG CTG GA Wild type Reverse A
65936 GCA TGG CCC GCA TCT ATC Mutant Forward A
65937 AGA GAG GTT CCA GAT AGG AGA GC Mutant Reverse A
65938 Fluorophore-1 CCA CCT TCT CAC CCT GAG TC Quencher-1 WT Probe
65939 Fluorophore-2 CAA GTC CTC GCT GTG GGT T Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
65934 0.40 uM
65935 0.40 uM
65936 0.40 uM
65937 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.