Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr16:32950183+32950302 120bp CAGTTTCCACTAGGAATTCTGGA TCGTGACAGGTCTGAAAGAAAA
Mutant= 80 bp
Wild Type = 120 bp
Wt Sequence: cagtttccactaggaattctggagaaatcaagtaattatgaagcatactaActaatttcagtaaaacaagtttcaaaggatggttttaagcttttatattttctttcagACCTGTCACGA
Mut Sequence: cagtttccactaggaattctggagaaatcaagtaattatgaagcatactaAGcctggtatgcacaagacactggttcagc
A 476 bp deletion beginning at Chromosome 16 position 32,950,234 bp and ending after 32,950,709 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65582 | CAG TTT CCA CTA GGA ATT CTG GA | Common | A | |||
| 65583 | TCG TGA CAG GTC TGA AAG AAA A | Wild type Reverse | A | |||
| 65584 | Fluorophore-1 | AGT TTC AAA GGA TGG TTT TAA GCT T | Quencher-1 | WT Probe | ||
| 65932 | GCT GAA CCA GTG TCT TGT GC | Mutant Reverse | A | |||
| 65933 | Fluorophore-2 | AGT AAT TAT GAA GCA TAC TAA GCC TGG T | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 65582 | 0.40 uM |
| 65583 | 0.40 uM |
| 65932 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.