For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr1:134196854+134196954 101bp AATGGAAGGCTTTGTTCTCC GAGAAAGCAAGTGTGGGTTCC
Mutant= 107 bp
Wild Type = 101 bp
The common primer (primer 65605) anneals over the nucleotide sequence containing mouse genomic variations rs30878889.
Sequence
Wt Sequence: aatggaaggctttgttctcccggtgaagaggcagctcgagctgtaggaacgtcgtAggtaggagctgtgatgtctagcccggaacccacacttgctttctc
Mut Sequence: aatggaaggctttgttctcccggtgaagaggcagctcgagctgtaggaacgtcgtATcggggctcaaaaggttcatcctgctaagaggctctggatgaaagtccagg
A 1002 bp deletion beginning at Chromosome 1 position 134,124,648 bp and ending after 134,125,649 bp.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65605 | AAT GGA AGG CTT TGT TCT CC | Common | A | |||
| 65606 | GAG AAA GCA AGT GTG GGT TCC | Wild type Reverse | A | |||
| 65607 | CCT GGA CTT TCA TCC AGA GC | Mutant Reverse | A | |||
| 65608 | Fluorophore-1 | AAC GTC GTA TCG GGG CTC | Quencher-1 | MUT Probe | ||
| 65609 | Fluorophore-2 | TAG GTA GGA GCT GTG ATG TCT AGC | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 65605 | 0.40 uM |
| 65606 | 0.40 uM |
| 65607 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.