For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr17:23644372-23644461 90bp GGCTCTTGGAGCTCTGGAAT CCCAGCTTCCCATTTTAGC
Mutant= 111 bp
Wild Type = 90 bp
Sequence
Wt Sequence: ggctcttggagctctggaatactgtcTctatcaggaggtttggtggctgagattcagaagtttgaaaaggagctaaaatgggaagctggg
MUT Sequence: ggctcttggagctctggaatactgtcTCtaaattgcaagaagttaaagatgttggtctcaggttccagcccagaccttggactctcactggccagtctttgtcaggctcca
A 638 bp deletion beginning at Chromosome 17 position 23643797 bp and ending after 23644434 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65577 | GGC TCT TGG AGC TCT GGA AT | Common | A | |||
| 65578 | CCC AGC TTC CCA TTT TAG C | Wild type Reverse | A | |||
| 65579 | TGG AGC CTG ACA AAG ACT GG | Mutant Reverse | A | |||
| 65580 | Fluorophore-1 | TGT CTC TAA ATT GCA AGA AGT TAA AGA TG | Quencher-1 | MUT Probe | ||
| 65581 | Fluorophore-2 | CTA TCA GGA GGT TTG GTG GC | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 65577 | 0.40 uM |
| 65578 | 0.40 uM |
| 65579 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.