For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr3:96893600-96893722 123bp GCCTAGTTGGCTGATTCCA GGGAGCTGAAATTAACAGCAA
Mutant= 115 bp
Wild Type = 123 bp
The common forward primer (primer 65572) anneals over the nucleotide sequence containing mouse genomic variation rs37776457.
Sequence
Wt Sequence: gcctagttggctgattccatgggtcgtattcaGcataggctccaagaactagagaccttaggaatactaaaagcatgagagtcgccgcttccctgcaaacctttgctgttaatttcagCTCCC
Mut Sequence: gcctagttggctgattccatgggtcgtattcaGGgcatattgaatgctggtcaactctgttattgtaacaagagttaatcggttaaaaggcagaaagatttattttagctcccag
A a 1011 bp deletion beginning at Chromosome 3 position 96,892,679 bp and ending after 96,893,689 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65572 | GCC TAG TTG GCT GAT TCC A | Common | A | |||
| 65573 | GGG AGC TGA AAT TAA CAG CAA | Wild type Reverse | A | |||
| 65574 | CTG GGA GCT AAA ATA AAT CTT TCT G | Mutant Reverse | A | |||
| 65575 | Fluorophore-1 | TCG TAT TCA GGG CAT ATT GAA TG | Quencher-1 | MUT Probe | ||
| 65576 | Fluorophore-2 | ATA GGC TCC AAG AAC TAG AGA CCT TAG | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 65572 | 0.40 uM |
| 65573 | 0.40 uM |
| 65574 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.