Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr2:38999897+38999987 91bp AGGCCTTGTGGTTGGAACT AAGACTTCACTGGGCCTGAG
Mutant= 93 bp
Wild Type = 91 bp
Wt Sequence: aggccttgtggttggaactacagataacaaatctggacCtggagggcaggacagtgccttgtgttctctgcctcagGCCCAGTGAAGTCTT
Mut Sequence: aggccttgtggttggaactacagataacaaatctggacCCtcttagtgcctcccctactctctccccacacccaatcagatgcaggttccagc
A 381 bp deletion beginning at Chromosome 2 position 38,999,936 bp and ending after 39,000,316 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65551 | AGG CCT TGT GGT TGG AAC T | Common | A | |||
| 65552 | AAG ACT TCA CTG GGC CTG AG | Wild type Reverse | A | |||
| 65553 | GCT GGA ACC TGC ATC TGA TT | Mutant Reverse | A | |||
| 65554 | Fluorophore-1 | TCT GGA CCC TCT TAG TGC CTC | Quencher-1 | MUT Probe | ||
| 65555 | Fluorophore-2 | ACA GTG CCT TGT GTT CTC TGC | Quencher-2 | WT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 65551 | 0.40 uM |
| 65552 | 0.40 uM |
| 65553 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.