Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr11:9028106-9028245 140bp GGGAGCTGTCCACACTGTTA GTTTGACATTTCCTGTAAAGATTGT
Mutant= 114 bp
Wild Type = 140 bp
Wt Sequence: gggagctgtccacactgttaaaattctgcagattagggaattcaggtccatgtccatgaaaCagaaggtaaatgttcaagcagttggcaaagattaataacaaaaaactatttttacaatctttacagGAAATGTCAAAC
Mut Sequence: gggagctgtccacactgttaaaattctgcagattagggaattcaggtccatgtccatgaaaCCgtaggagacatacaccactgtatattattatgaaccacaatgacactcctt
A 409 bp deletion beginning at Chromosome 11 position 9,027,775 bp and ending after 9,028,183 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65546 | GGG AGC TGT CCA CAC TGT TA | Common | A | |||
| 65547 | AAG GAG TGT CAT TGT GGT TCA T | Mutant Reverse | A | |||
| 65548 | GTT TGA CAT TTC CTG TAA AGA TTG T | Wild type Reverse | A | |||
| 65549 | Fluorophore-1 | AGG TAA ATG TTC AAG CAG TTG GC | Quencher-1 | WT Probe | ||
| 65550 | Fluorophore-2 | CCA TGA AAC CGT AGG AGA CAT ACA | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 65546 | 0.40 uM |
| 65547 | 0.40 uM |
| 65548 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.