For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr17:88689733+88689833 101bp GAAGTCTTTAAGGTTGCCAGGA TCAATAGGTCATGTTAGACCAAGC
Mutant= 102 bp
Wild Type = 101 bp
Sequence
Wt Sequence: gaagtctttaaggttgccaggaaatgtatatagttcaatactttccCctcagatggagccagtaagtttagaatttagcttggtctaacatgacctattga
Mut Sequence: gaagtctttaaggttgccaggaaatgtatatagttcaatactttccCCtcagtgcagctatgcatcagagtgaggacattcctgacactgtagcatgtggga
A 406 bp deletion beginning at Chromosome 17 position 88,689,780 bp and ending after 88,690,185 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65482 | GAA GTC TTT AAG GTT GCC AGG A | Common | A | |||
| 65483 | TCA ATA GGT CAT GTT AGA CCA AGC | Wild type Reverse | A | |||
| 65484 | TCC CAC ATG CTA CAG TGT CA | Mutant Reverse | A | |||
| 65485 | Fluorophore-1 | TAC TTT CCC CTC AGT GCA GCT A | Quencher-1 | MUT Probe | ||
| 65486 | Fluorophore-2 | CCT CAG ATG GAG CCA GTA AGT T | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 65482 | 0.40 uM |
| 65483 | 0.40 uM |
| 65484 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.