For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr16:49069147+49069236 90bp AGCAGTTAGTTCATCTCCCAGAG GTGATTTCTAACAGAAGCCAACAG
Mutant= 123 bp
Wild Type = 90 bp
Sequence
Wt Sequence: agcagttagttcatctcccagagatcaagaggcaaTacgaggtcttgatgtcagcttaacccagatctgttggcttctgttagaaatcac
Mut Sequence: agcagttagttcatctcccagagatcaagaggcaaTTcatttaaagagactccttatgaactgtattgtacaagctagttaattccttctcagggaagagcccttcagtcttgcgaatagtca
A 1220 bp deletion beginning at Chromosome 16 position 49,069,183 bp and ending after 49,070,402 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65476 | AGC AGT TAG TTC ATC TCC CAG AG | Common | A | |||
| 65477 | GTG ATT TCT AAC AGA AGC CAA CAG | Wild type Reverse | A | |||
| 65478 | TGA CTA TTC GCA AGA CTG AAG G | Mutant Reverse | A | |||
| 65479 | Fluorophore-1 | AGA GGC AAT TCA TTT AAA GAG ACT CC | Quencher-1 | MUT Probe | ||
| 65480 | Fluorophore-2 | CGA GGT CTT GAT GTC AGC TTA AC | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 65476 | 0.40 uM |
| 65477 | 0.40 uM |
| 65478 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.