For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr10:18174296-18174415 120bp GCTAGAGTTAAAGTCGCAGAATCCTA TGAGAAGTGGTTTTGGTGACTA
Mutant= 118 bp
Wild Type = 120 bp
The wildtype reverse primer (primer 65472) anneals over the nucleotide sequence containing mouse genomic variation rs33609550.
Sequence
Wt Sequence: GCTAGAGTTAAAGTCGCAGAATCCTAtaagaatgctgggtaagtgtctcaaggtggcatatacacaaatacatataaacttatataggaggtaatataTAGTCACCAAAACCACTTCTCA
Mut Sequence: gctagagttaaagtcgcagaatcctataagaatgctgggtaagtgTTGAACcttttcctggtacgcagatgctgaacaatggatttacaaacagatacccatataggagatgatgctg
A 499 bp deletion beginning at Chromosome 10 position 18,173,871 bp and ending after 18,174,369 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65471 | GCT AGA GTT AAA GTC GCA GAA TCC TA | Common | A | |||
| 65472 | TGA GAA GTG GTT TTG GTG ACT A | Wild type Reverse | A | |||
| 65473 | CAG CAT CAT CTC CTA TAT GGG TAT C | Mutant Reverse | A | |||
| 65474 | Fluorophore-1 | TTG AAC CTT TTC CTG GTA CGC | Quencher-1 | MUT Probe | ||
| 65475 | Fluorophore-2 | CTC AAG GTG GCA TAT ACA CAA ATA CA | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 65471 | 0.40 uM |
| 65472 | 0.40 uM |
| 65473 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.