For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:59186041-59186161 121bp TGGGGACAGTGGTATCTGTTC GGAGAAGAAGAGAGCTTTCCAG
Mut= 106 bp
Wt= 121 bp
Fam=Mut
Hex=Wt
The WT Reverse primer (primer 65355) anneals over the nucleotide sequence containing mouse genomic variations rs214496484.
Sequence
Wt Sequence (deletions in lower case):
CCAGCAGGAGAATCTCTCTTGCTGTTGGGTTCACAGCTTGATTAGAGTCTGCATCATAGTGAAGGCTGAACCTTCTTCCTGCCTGGTGTATGGAACCTGGCCATTTCCAATCCTTCAGCAAAGACAATGGGGACAGTGGTATCTGTTCCAGCCTAGATCTGGCCATAGCAGTCCTGTgtagggtggagaggggccaggccaggcagggatgggttttgggtaccttctggaaagctctcttcttctccagattactactttgtgaccagggagatgatgcagcgtgatattgcagcaggggacttcattgagcatgctgagttctcagggaacctgtacgggacaaggtgggctgagtttggtgtgggcccagcttcatggatcagggtaattccagaactgttaacaaaagaaagcactctagcatgtcacctctgacctcacagtgccctcccagtctcccgcctagggctgggatggcttgctaaccccctagtctctgagcatagctgataggctccagggaacaagcaggcccagtcatgccccaggctcatctgtcctcaagccatctggcgaggcaaagagccacatgaggcacctcacGTGGAGAGGTAGGCAGTGCCAGGCAGCCCAGGCCCAAACCTTTTTGGCTTTCGGCTACAGGACAGGTACAAAGGGCTGTGATGTCAGAGGGCCTGACAGGGTTGACTATATGCTTGGAAGTTCTGGAAAGTACAGAAGGTGCTGGGTTCACGAGAGCCTCTGCACTACCCAGGCCAGGCCCAGAATGGGCCTTGGGGTGGAAAGGGC
This mutation is a a 429 bp deletion beginning at Chromosome 11 position 59,185,683 bp and ending after 59,186,111 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 64355 | TGG GGA CAG TGG TAT CTG TTC | Common | A | |||
| 64358 | Fluorophore-1 | AGC AGT CCT GTG TGG AGA GGT AGG | Quencher-1 | MUT Probe | ||
| 65355 | GGA GAA GAA GAG AGC TTT CCA G | Wild type Reverse | A | |||
| 65356 | AGC CGA AAG CCA AAA AGG T | Mutant Reverse | A | |||
| 65357 | Fluorophore-2 | CAG GGA TGG GTT TTG GGT A | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 64355 | 0.40 uM |
| 65355 | 0.40 uM |
| 65356 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.