For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 91 bp
Wild Type = 98 bp
>chr11:120716785+120716882 98bp AGGAAATGTCCATCTTTTGTGG CAAGGCAGGATCAGGCTGTA |
Sequence
Wt Sequence (deletions in lower case):
AGGAAATGTCCATCTTTTGTGGGTAGTACAGCAAATTCCCCATATgtgcaaaagataccagggcatcccaagaccctgtacagcctgatcctgccttgacgcactgaagtgcttcacctgaggggaactggacaggggtttctgatgtgctgtgggtgtgttgcagttctgggctccccaatgaccaacttccagacacaggcagcacaggactgggttagccattgaccctaatattgagcccagcagataacatgacactttctgacagagcaagccatggaccacaaccaggaccgactcactgcctttcgggagaaccaagcacgcaccaagatccttagcaaggaagttcaacacctccaggaggagaagtccaagcaggtgagtgctctcactagccctgggctggctgccttctccttgtgGTATATCTATCCTCCAGGCCTCTGAGACAAGACTAGACAGGGCCGA
This mutation is a 383 bp deletion beginning at Chromosome 11 position 120,716,830 bp and ending after 120,717,212 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65298 | AGG AAA TGT CCA TCT TTT GTG G | Common | A | |||
| 65299 | CAA GGC AGG ATC AGG CTG TA | Wild type Reverse | A | |||
| 65300 | TCG GCC CTG TCT AGT CTT GT | Mutant Reverse | A | |||
| 65301 | Fluorophore-1 | AAG ATA CCA GGG CAT CCC A | Quencher-1 | WT Probe | ||
| 65302 | Fluorophore-2 | TAT GTA TAT CTA TCC TCC AGG CCT CTG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 65298 | 0.40 uM |
| 65299 | 0.40 uM |
| 65300 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.