For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr14:8644673-8644772 100bp CGTGCACATGGTCTATGCTC ACTTGGGGCACTGGTGAAAT
Mutant= 118 bp
Wild Type = 100 bp
Sequence
Wt Sequence cgtgcacatggtctatgctcacattctcttatggcatagtgaaagaGtgaataaaaatcctgtttttgattttcataaaaatttcaccagtgccccaagt
Mut Sequence: cgtgcacatggtctatgctcacattctcttatggcatagtgaaagaGTgacttaccaggttgacatgaagtaattaagataatttaattgtatttcttggatatcactgtacgtgtca
A 442 bp deletion beginning at Chromosome 14 position 8,644,284 bp and ending after 8,644,725 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65262 | CGT GCA CAT GGT CTA TGC TC | Common | A | |||
| 65263 | ACT TGG GGC ACT GGT GAA AT | Wild type Reverse | A | |||
| 65264 | TGA CAC GTA CAG TGA TAT CCA AGA | Mutant Reverse | A | |||
| 65265 | Fluorophore-1 | AGT GAA TAA AAA TCC TGT TTT TGA TTT T | Quencher-1 | WT Probe | ||
| 65266 | Fluorophore-2 | TGA AAG AGT GAC TTA CCA GGT TGA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 65262 | 0.40 uM |
| 65263 | 0.40 uM |
| 65264 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.