For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr12:76427586+76427680 95bp CCCCTCAAGCTCTCATTGC TCACTGCTCTGTCCCTCAAA
Mutant= 84 bp
Wild Type = 95 bp
Sequence
Wt Sequence: cccctcaagctctcattgcaagccaattcCctgtgtatctcaggatacactagatacagctgaattaaaatattctttgagggacagagcagtga
Mut Sequence: cccctcaagctctcattgcaagccaattcCCtgggcttgtgcctctgtaatggcactgtgtgattctgggagttgttcatacca
A 10249 bp deletion beginning at Chromosome 12 position 76,427,616 bp and ending after 76,437,864 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65257 | CCC CTC AAG CTC TCA TTG C | Common | A | |||
| 65258 | TCA CTG CTC TGT CCC TCA AA | Wild type Reverse | A | |||
| 65259 | TGG TAT GAA CAA CTC CCA GAA | Mutant Reverse | A | |||
| 65260 | Fluorophore-1 | CAA TTC CCT GGG CTT GTG | Quencher-1 | MUT Probe | ||
| 65261 | Fluorophore-2 | TGT GTA TCT CAG GAT ACA CTA GAT ACA GCT | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 65257 | 0.40 uM |
| 65258 | 0.40 uM |
| 65259 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.