Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr1:162850466-162850572 107bp CCCAGGACACAATCAGTAAATC AGAACCTTGGGGGTAGTTCA
Mutant= 85 bp
Wild Type = 107 bp
Wt Sequence: cccaggacacaatcagtaaatcagaacttaattcttaTttgcatatgtgcattcaatagaaacaaaaaaaatagattatttgaaccttgaactacccccaaggttct
Mut Sequence: cccaggacacaatcagtaaatcagaacttaattcttaTAcctggttagtcccaggatgaactcttgtggattgtccgttaaacag
A 526 bp deletion beginning at Chromosome 1 position 162,850,009 bp and ending after 162,850,534 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65252 | CCC AGG ACA CAA TCA GTA AAT C | Common | A | |||
| 65253 | AGA ACC TTG GGG GTA GTT CA | Wild type Reverse | A | |||
| 65254 | CTG TTT AAC GGA CAA TCC ACA A | Mutant Reverse | A | |||
| 65255 | Fluorophore-1 | TGC ATA TGT GCA TTC AAT AGA AAC | Quencher-1 | WT Probe | ||
| 65256 | Fluorophore-2 | TTC TTA TAC CTG GTT AGT CCC AGG A | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 65252 | 0.40 uM |
| 65253 | 0.40 uM |
| 65254 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.