Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr13:21981553+21981639 87bp CTCTCAGCATGGGCAGCTA CAGGCTTCTCCCCTGAGTCT
Mutant= 81 bp
Wild Type = 87 bp
Wt Sequence: ctctcagcatgggcagctacctgggCAAAGCGGGGTCCTCGCCGCGGTCCCCAGCACAGGGGCGCGCAGACTCAGGGGAGAAGCCTG
Mut Sequence: CTCTCAGCATGGGCAGCTACCTGGgcATCACACTTACAAGAAATAGCCCACTCTCTCTGTCACACTGCAACAGAGTCTTGA
A 2881 bp deletion beginning at Chromosome 13 position 21,981,578 bp and ending after 21,984,458 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65247 | CTC TCA GCA TGG GCA GCT A | Common | A | |||
| 65248 | CAG GCT TCT CCC CTG AGT CT | Wild type Reverse | A | |||
| 65249 | TCA AGA CTC TGT TGC AGT GTG A | Mutant Reverse | A | |||
| 65250 | Fluorophore-1 | TGG GCA TCA CAC TTA CAA GAA ATA | Quencher-1 | MUT Probe | ||
| 65251 | Fluorophore-2 | TGG GCA AAG CGG GGT | Quencher-2 | WT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 65247 | 0.40 uM |
| 65248 | 0.40 uM |
| 65249 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.