For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:158000978-158001057 80bp CTGGACATTCGAGAGCGATG TGCTGTTTTTCAGTGGCTTT
Mutant= 110 bp
Wild Type = 80 bp
The common forward primer (primer 65238) anneals over the nucleotide sequence containing mouse genomic variations rs27309128 and rs218935467.
Sequence
Wt Sequence: ctggacattcgagagcgatgtataagagttgtcctGaggcgggaaagtgcctcacctgctaaagccactgaaaaacagca
Mut Sequence: ctggacattcgagagcgatgtataagagttgtcctGCaagagggagctgagtcccctaccttgaaaactgtgaagcctagtgggttcactgagtccccaaggcaaagagt
A 4131 bp deletion beginning at Chromosome 2 position 157,996,891 bp and ending after 158,001,021 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65238 | CTG GAC ATT CGA GAG CGA TG | Common | A | |||
| 65239 | TGC TGT TTT TCA GTG GCT TT | Wild type Reverse | A | |||
| 65241 | ACT CTT TGC CTT GGG GAC TC | Mutant Reverse | A | |||
| 65243 | Fluorophore-1 | TCC TGC AAG AGG GAG CTG A | Quencher-1 | MUT Probe | ||
| 65244 | Fluorophore-2 | CGG GAA AGT GCC TCA CCT | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 65238 | 0.40 uM |
| 65239 | 0.40 uM |
| 65241 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.