For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr6:119198583+119198689 107bp AATGACGTCTCAAAGCCAAGA CTTCCCTGCCTCTACCCAAC
Mutant= 98 bp
Wild Type = 107 bp
The common forward primer (primer 65228) anneals over the nucleotide sequence containing mouse genomic variation rs261140489
Sequence
Wt Sequence : aatgacgtctcaaagccaagaagtttagcatcctgatctcattttcaatctgtAgccgcttggttatgaagcgctcaccaactgcctgttgggtagaggcagggaag
Mut Sequence: aatgacgtctcaaagccaagaagtttagcatcctgatctcattttcaatctgtAGaggatggtgagtttcagactagcctggactacatagtgaagta
A 2545 bp deletion beginning at Chromosome 6 position 119,198,637 bp and ending after 119,201,181 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65228 | AAT GAC GTC TCA AAG CCA AGA | Common | A | |||
| 65229 | CTT CCC TGC CTC TAC CCA AC | Wild type Reverse | A | |||
| 65230 | TAC TTC ACT ATG TAG TCC AGG CTA GT | Mutant Reverse | A | |||
| 65231 | Fluorophore-1 | CAA TCT GTA GAG GAT GGT GAG TTT C | Quencher-1 | MUT Probe | ||
| 65232 | Fluorophore-2 | TGG TTA TGA AGC GCT CAC C | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 65228 | 0.40 uM |
| 65229 | 0.40 uM |
| 65230 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.