Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr11:120795185-120795265 81bp CACCAGTGTCACCTTGATCCT CCACTGGCACAGACTTGTAAA
Mutant= 89 bp
Wild Type = 81 bp
Wt Sequence: caccagtgtcaccttgatccttctccgtctcagtaccctccTgtcgagaaccaacagttctttacaagtctgtgccagtgg
Mut Seq: caccagtgtcaccttgatccttctccgtctcagtaccctccTCatggggagagttaatccctgcctctgactgtg
A 434 bp deletion beginning at Chromosome 11 position 120,794,790 bp and ending after 120,795,223 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65223 | CAC CAG TGT CAC CTT GAT CCT | Common | A | |||
| 65224 | CCA CTG GCA CAG ACT TGT AAA | Wild type Reverse | A | |||
| 65225 | CAC AGT CAG AGG CAG GGA TT | Mutant Reverse | A | |||
| 65226 | Fluorophore-1 | TCT CAG TAC CCT CCT CAT GGG | Quencher-1 | MUT Probe | ||
| 65227 | Fluorophore-2 | CTC CTG TCG AGA ACC AAC AGT T | Quencher-2 | WT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 65223 | 0.40 uM |
| 65224 | 0.40 uM |
| 65225 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.