For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr4:41728303-41728383 81bp TTCTCCTCTCCCTGTATTTGC TCTATCTACGCGACCTGTCC
Mutant= 100 bp
Wild Type = 81 bp
Sequence
Wt Sequence ttctcctctccctgtatttgccacgtgcaaggtctgagctaCctagaggcaccactagctaggacaggtcgcgtagataga
Mut Sequence:
ttctcctctccctgtatttgccacgtgcaaggtctgagctaCACTCATTAACCTGGtgagatcaattaggaaggtgggagggagaactggtcaggactgg
A 517 bp deletion beginning at Chromosome 4 position 41,727,825 bp and ending after 41,728,341 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000527822 (exon 3) and 444 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 103 and early truncation 3 amino acids later. There is a 13 bp insertion (ACTCATTAACCTG) at the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65211 | TTC TCC TCT CCC TGT ATT TGC | Common | A | |||
| 65212 | TCT ATC TAC GCG ACC TGT CC | Wild type Reverse | A | |||
| 65213 | CCA GTC CTG ACC AGT TCT CC | Mutant Reverse | A | |||
| 65214 | Fluorophore-1 | AGC TAC CTA GAG GCA CCA CTA GC | Quencher-1 | WT Probe | ||
| 65216 | Fluorophore-2 | CAT TAA CCT GGT GAG ATC AAT TAG GA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 65211 | 0.40 uM |
| 65212 | 0.40 uM |
| 65213 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.