Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
Mutant= 128 bp
Wild Type = 127 bp
>chr5:139353973+139354099 127bp CCATCTTCCAGCACATCCA TCCTGTCTTGCAATAGGCTGA |
Large deletion: Mutant sequence with junction in uppercase
ccatcttccagcacatccagcgaggtgggggtaggtgggcattggggttccttgccagatgggggggagactaggCCtggagtgggcactgatgttgggtgaacccccagtaaacaccagtgctttcc
This mutation is a 1837 bp deletion beginning at Chromosome 5 position 139,354,049 bp and ending after 139,355,885 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65184 | CCA TCT TCC AGC ACA TCC A | Common | A | |||
| 65185 | TCC TGT CTT GCA ATA GGC TGA | Wild type Reverse | A | |||
| 65186 | GGA AAG CAC TGG TGT TTA CTG | Mutant Reverse | A | |||
| 65187 | Fluorophore-1 | TGG ATT GGT ACT AGG GAG AGA CAG | Quencher-1 | WT Probe | ||
| 65188 | Fluorophore-2 | AGA CTA GGC CTG GAG TGG GC | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 65184 | 0.40 uM |
| 65185 | 0.40 uM |
| 65186 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.