For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 84 bp
Wild Type = 94 bp
>chr11:33518210-33518303 94bp TGGGTATTGCTTTTATAATTTCTCG ATTGCATCCTCTGCTCCATT |
Sequence
Wt Sequence (deletions in lower case; insertions with carrots ^g^ (g insertion):
TGGGTATTGCTTTTATAATTTCTCGAGTTTTGTTTCCAACCCAC^A^taatgtagatacaccggctgcggagtctgaaatggagcagaggatgcaattggtggttagatggaggagagcttgtgtttgtgtttctatgtaagtctttctgttttttttttcttccttctcaggtgacccagttcggatagcactgactctggacatcgccagcatctctagcatctcagagagtaacatggtaaccagtgccacccccaccccttcccccgctccctctccttgctttcaattgtaatgtcctttcaagtaaatcagaaacagagtggcagatgccagagttctgtcttgtaagtggagacagtagatgtttataggttttctgggtatcaggaagggaacagactcaaaggccaggaagagagaaagtagaaaaggaagtgaccgattgactgaggaataaaaacatgtccacacgGTCTTTCAGTCGAGGGACAGCTGATAAAACTTACAATGT
This mutation is a 430 bp deletion beginning at Chromosome 11 position 33,517,830 bp and ending after 33,518,259 bp with a signle bp A insertion at the junction(GRCm39/mm39).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65043 | TGG GTA TTG CTT TTA TAA TTT CTC G | Common | A | |||
| 65044 | ATT GCA TCC TCT GCT CCA TT | Wild type Reverse | A | |||
| 65045 | ACA TTG TAA GTT TTA TCA GCT GTC C | Mutant Reverse | A | |||
| 65046 | Fluorophore-1 | ATG TAG ATA CAC CGG CTG CG | Quencher-1 | WT Probe | ||
| 65047 | Fluorophore-2 | TTC CAA CCC ACA GTC TTT CAG TC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 65043 | 0.40 uM |
| 65044 | 0.40 uM |
| 65045 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.