For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:70659920-70660005 86bp CCGACCTGAGAGTTTGGAAAG TCCAAAGACCCTCCTCCAG |
Mutant= 91 bp
Wild Type = 86 bp
Sequence
Large deletion: Mutant sequence with junction in uppercase
ccgacctgagagtttggaaagctccaggcgtgtgatTCacactagccagcctctgactgctggcctgaagccatcttcctccctcagccct
This mutation is a 13601 bp deletion beginning at Chromosome 8 position 70,646,368 bp and ending after 70,659,968 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 62861 | CCG ACC TGA GAG TTT GGA AAG | Common | A | |||
| 62862 | TCC AAA GAC CCT CCT CCA G | Wild type Reverse | A | |||
| 62863 | AGG GCT GAG GGA GGA AGA T | Mutant Reverse | A | |||
| 63877 | Fluorophore-1 | TGG TGG GTC CCT TAC AGG A | Quencher-1 | WT Probe | ||
| 64909 | Fluorophore-2 | AGG CGT GTG ATT CAC ACT AGC CA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 62861 | 0.40 uM |
| 62862 | 0.40 uM |
| 62863 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.