For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr14:35026435+35026539 105bp AACTGCCAGAACTCAGAGCAC GGTTGTCTGGTAGCATCAGG |
Mutant= 111 bp
Wild Type = 105 bp
Sequence
Wt Sequence (deletions in lower case):
AACTGCCAGAACTCAGAGCACATGGGAGAGTATAGAGCTTGTTACAAAGGGTGATTCTGGCatagcttgggtggcagaaagggttcctgatgctaccagacaaccaccttatatcctggggctggatactgatgagggatactgggtctatgttgctgccttgcaccatgctctgaataagtgaagtagatggggactcttgttacttctgatggttgcgtgagttgggtgtgttggcgttagttgccctctcagatagatcctttcccacttaaaaaaatgattctttcccctcttcttccatgctcagatatccgtgggctccaaagcttcctggatcaggcctcaaggctgggtctggatgtctctttacaaaaggtggacaagaacatcagtcacgtgttcactagccttttcaccaccatgaagaccgaggagctgaatcgctaccgggacacactgcgccgtgccattctactgctcagcccacagggggcgcactccttcatcaatgaggtaggtcatgggatctgaggccattcatgcctgatgctcaggactgctgaatggcctaagtgtgtaccagaaacaacagagaacagagggctcagcccacagcacctaaccattcaggaagaggcctgaatgtgacttggatactggtttgtcctcagcagatgactcggttccttcacagaccacgaggaggctttgaggctggtgagaagcctgcATATGTTACTGCCTCAATTCTCTGAGTTGAAACCCAGCATTTTTATTCCC
This mutation is a 672 bp deletion beginning at Chromosome 14 position 35,026,496 bp and ending after 35,027,167 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 64872 | AAC TGC CAG AAC TCA GAG CAC | Common | A | |||
| 64873 | GGT TGT CTG GTA GCA TCA GG | Wild type Reverse | A | |||
| 64874 | GGG AAT AAA AAT GCT GGG TTT C | Mutant Reverse | A | |||
| 64875 | Fluorophore-1 | ATA GCT TGG GTG GCA GAA AGG | Quencher-1 | WT Probe | ||
| 64876 | Fluorophore-2 | TGA TTC TGG CAT ATG TTA CTG CCT C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 64872 | 0.40 uM |
| 64873 | 0.40 uM |
| 64874 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.