For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 93 bp
Wild Type = 100 bp
>chr14:75123208-75123307 100bp CCAATCCTGTCTGGGTGAGT GGCATGGATGCTCTCACAA |
Sequence
Wt Sequence (deletions in lower case):
CCAATCCTGTCTGGGTGAGTGCAGGATCTGGGgagttgattccagactacctggatcgccaatccctttggtaattcattcttgtgagagcatccatgccacttagccatggaagtcataataccctatggtttgacattttgaatatctatctatctatctatctatctatctatctatctatctatctatctatctatctatttattagctgttcagagaaccaccagaacaataggcccagatgcccatgtcttacgaggggaaggctttaaggctgttgcagcaacacgctctgaaacagtactggcgctgaccaccctggccataataaattgccaaatatatggaagaaatgcacttaatcttaaggtatgttagacctccttaatagtcatgcccattggtattatcagttatttttaccttttcagtttctcaatctaggttagttttcattacattgaaggagcttttcctattaccgcagacacttcccaggaatacatgcaaaacatacctccaaacttaacttatctaagtttatcttcagttcaccaataaagtttaaaaggttgctgcgatccagagaagtcatactgtttttatttttttttccctcatttattctgggAAGCAGGATTGAAATTGTTCATGTTTCTAAATTACCAGAAGCTTTGGACCTTGTGTCAAGT
This mutation is a 602 bp deletion beginning at Chromosome 14 position 75,122,674 bp and ending after 75,123,275 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 64771 | CCA ATC CTG TCT GGG TGA GT | Common | A | |||
| 64772 | GGC ATG GAT GCT CTC ACA A | Wild type Reverse | A | |||
| 64773 | ACT TGA CAC AAG GTC CAA AGC | Mutant Reverse | A | |||
| 64774 | Fluorophore-1 | TTC CAG ACT ACC TGG ATC GC | Quencher-1 | WT Probe | ||
| 64775 | Fluorophore-2 | CAG GAT CTG GGA AGC AGG ATT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 64771 | 0.40 uM |
| 64772 | 0.40 uM |
| 64773 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.