For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr13:96420476-96420613 138bp CCAGAGGTCACTGCAATAGG CCCACTCAATAGGCCAAAGT
Mut= 126 bp
Wt= 138 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case):
GTTAAGGATGCATACTAGGGGCATTGATGAGAAAATCAAATACATCAAAGAGAGAGGCTAGTGTTGAGTGTAAGGCCATTAAAGCCATTGGCTGTGATGTCTCACTCGCCATCATGTCCCCTCAGCTCTTTTTGAAAGTGGGTGATATCAGTCGGCAACACAGACACAACACTGCAAACTCACTCACGTTTGCTGTTTCAGACACAGTACACACACTTCTTGTTCCAGACATTTCCATCcaacttggatgacaaaagatgttctaggacagactgaaaggagtcagctgctgccttaccaatcctttatgacgtaaggtgacaagtgagcattttagagtcaatagctactgctaattttcaacttaggagcaccgtgagagcatccaggactcagcagtgagctctacactgacgttcaagcaggaccatagtctggagaccaggcaaatccgcacactgctctggaacctggcctatcggcagctgaaaaagaaagactggcagaggctggcccgcttgtggagttttacagaggaccagatcagagccattgaggaacagtggtcaggtgagtggcggccagatgacatggacaggatgaagccagttaaagttaggagtaatggtctttccctcctcaagagtcagtgcctggtgcacacaattggcagaagccagaggtcactgcaataggggtagttagcatggctcagtctgcaaaggtggtttggaatttagcagagagctacactcctgagaatGTTCGGTTAGCTGTGCTTGCAAAGGTTGACTACTTTGGCCTATTGAGTGGGGACCAAAGAAGCAAGGACACAATCCCTGGAATGCCTCTGGAATGCCAGTTTGGCTTTCACTAAAGTTTGCAGGTTGTTCTGGGATGAAAGGTCTTCCTCCGCCACAGAAAGCTTTAGTACCGAAGGTT
This mutation is a 524 bp deletion beginning at Chromosome 13 position 96420527 bp and ending after 96421050 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 64405 | CCA GAG GTC ACT GCA ATA GG | Wild type Forward | A | |||
| 64406 | CCC ACT CAA TAG GCC AAA GT | Common | A | |||
| 64407 | CAC AAC ACT GCA AAC TCA CTC A | Mutant Forward | A | |||
| 64408 | Fluorophore-1 | CTC AGT CTG CAA AGG TGG TTT G | Quencher-1 | WT Probe | ||
| 64763 | Fluorophore-2 | ACA TTT CCA TCG TTC GGT TAG CTG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 64405 | 0.40 uM |
| 64406 | 0.40 uM |
| 64407 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.