For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr14:101199487-101199588 102bp GAGGGTCTTGAGGTCCCACT TGCGGAGGAAAAGATTTTGA
Mut= 94 bp
Wt= 102 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case):
TGGGATTGCAGGCTCATGCCAGCATGTCATGCTTATGTGGTGTTGGGTATCATACCAAGGACTTCACGAATGCTTGGCAAACAATCTACCTGCTGAACAACAGCCAAAGACCTCACATGGAGGGTCTTGAGGTCCCACTAGAAATGAGCACCTGAAGCAGAAtccaggagtgggccaatcatccctacattttgacctctgtcaaaatcttttcctccgcaggtcctacaggctgtgtcttcctcctgattccatccagatagttgtggttgtcccttagctcctcaggaacagccctcatcctctgtttccgtacgcactgcacctccagcgaatggctaaggagacgtgaggagccaagcttagatgcaggctctggactgagcacgccacagccaggtagaagaggctgcgtgtcctcttggcctgctgctgatgcctgcagctgttgaggccatactgtgcacagaaggcagtcttgaccaccagccacagctggcctcagagatctcccacgctgactgttgggtccctaaccactggtcttgtccaccccatccacttccctcctggattcaaggcaatgttgcctgtaaacaaggaccaggtgctgctacagaacacagtacctccagggtgtccccctcaggtcctctcacagtttgtgaattcccctgcccccaacttagcatctctttgtccccatccgaccctcccttcttcccactttcctctgcctgcccccccacaggcttatttcttctcttctttgactcagactcactctcctgggcctcacttctcttcggactcaaattctgactttgttcctcctcactcttctagtcacccacgatcctcttcttgctttggccaaaactatacttattttggtgaaaaactcccctctccacactccatctctccctctaactatcagctctgtgtgtctccccctctcaccggctcctcctctctttcccagctacaacactcctctcctcactcctgtcagtccccttcccgccttcaggacttacaaagccccaagatcacttccccggtccccagctcaccttctccaaggattcagaataacaagcaaacatggcagtggcctcagtccggaagcatcaagtcttctcggggggcaggggtatgtgtgccaagcaaggtggaccctgcagaattcaaggactcagggaccctcacccaagccctggtggaccatgtggggcgccgcagaattgcacgagacctgcagatacagtttctgcagcgcctgtggctcggcacacccggccatgccccagtcgtggagtaccccatatgtctagtgtgcctccagatccgcaccccatcttgtcccacccccaagtacaagactgtaccccagctgcttgccttccctcaactactaccctgtgtccagggccaggaatctgggcctctccgaataggaattggcttcggcctccgcctgcctcggggccaggccagggctttgcatctgctgcccccaaaaaactctactccggtgggagtagagtctcaggaagaggccctccagcgacaaaaatccacaatccaagaatcagttcaaatcaccggcacactcttccaggcccggagcctccggtctatagaccttcaatcaccaaaacccagccagtgttccaggtctctacttcaggaaccaagacaggtcgctgcatccccaaaggccgggccttctgtctcaaagaggtctgtgactctagggtctattctccgaaagtcgccatcttaatcccagtgcagcgaagaccctctggaacaccacctccaaactctaccttccctaccaggacttctcagaccttggagggctggctggctggaagccaggtgtgttctcctgccctgaaccctgggaaccccttgtggagtttgctctcccctagttgaagagaccagaggcacccaaggcctcatttagccttcagtgtatccaataaagcctaactccgagaatcttatgtttgtgtctactatgcccacaggatggaatcaaggctatgggataaagttagtccgacaaaagacttggcgggggggcgggggggcgcggagaaagattaaggataccaactGCTATCACTTGAGTACATGCTAGTACCTGATGCTTAGAGACCTCCACAAGGCCCTTCTCCTGTTTAACTCAAGTCTGTGGACAGATAGTTGGAATCAAAGATTAGGCCAATGGGTCTATTTCTCCAGGGACAGCCTGGGTTGACCAGGATGCAGCAGCTCATTTTCCTCACAGGGAAGGACATTGT
This mutation is a 1970 bp deletion beginning at Chromosome 14 position 101,435,012 bp and ending after 101,436,981 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 64695 | GAG GGT CTT GAG GTC CCA CT | Common | A | |||
| 64696 | TGC GGA GGA AAA GAT TTT GA | Wild type Forward | A | |||
| 64697 | CCT TGT GGA GGT CTC TAA GCA | Mutant Reverse | A | |||
| 64698 | Fluorophore-1 | CAA TCA TCC CTA CAT TTT GAC CTC | Quencher-1 | WT Probe | ||
| 64699 | Fluorophore-2 | CCT GAA GCA GAA GCT ATC ACT TGA G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 64695 | 0.40 uM |
| 64696 | 0.40 uM |
| 64697 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.