For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr12:8323625+8323726 102bp TCTGGGAACTCCTGCCTTAG CAAGTGCTGTGCTATCCCACT
Mut= 84 bp
Wt= 102 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case):
AATTAAGATAGACGGACAGACAGACACACAGTTAACAGTTGTTAGGAGAGAGGCTTTTCTCACATAGTGTAACTGTTATAAGCACCCCATGCCCCTGTAAGTAGCCCCAGTTAATTCAGCTCGTTAAGCTACACATGGGTGGAATCCTACTGCTGTTATGCAGATAGCACCCTATCAACATAGAATGTCTCCCTGGAAAAAGTTTATAAAACACTTCTGGGAACTCCTGCCTTAGGCTTCGTCTGACGTTCCccatggccaggcagcagcggggtcccttgagcgtcatgtcacatagtgggatagcacagcacttggcgctctccagactctccacttaggtgtcaggaggttaatgcaatccctcagcctcagaacctggcttaggcttaggcaggtgggtgtggtgatgtcgccttgagagtagacagcaagctcttgttttccttttcttccacaggcaccagagccccaggggctacgggccttgccacccgagatccctctgtcttggatgacacagccagccagccaggggacagtgatgaggcttttgacttctttgagcagcaggatgaagtgcagccacccacactgggcctgagcagcaaggatgtggagaagtccttggtgggagaagaggaggaggaggaggaggaggaggaggtgctggatcccctgggtatcatgcggtaggtctccacttcttccgatgTCATTTGTTCAAGGTCTGGGCCATGGGGCTTTAACCTGGTGTGCTCAAGAGAGTTGGCTCAGCTCCGCCGCCTCAGTATCACCCGCCTTTGTGGCTGGGCTCAGAATCCCCCGCCCTCCCCAGTGATATCCCCCATCTATGGCTAACTCCACAGAGTTAACCCCACGATAGCTCGGTAGCACAGACTGCTGGGCCCAGTCTGCTGCCATTGGGACCCGGCTTCTCCTTGCAGAGTGGCAAGTGACTTGTTTGCCCCCAGAGCATGCTT
This mutation is a 463 bp deletion beginning at Chromosome 12 position 8,373,662 bp and ending after 8,374,124 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 64685 | TCT GGG AAC TCC TGC CTT AG | Common | A | |||
| 64686 | CAA GTG CTG TGC TAT CCC ACT | Wild type Reverse | A | |||
| 64687 | TGA GCA CAC CAG GTT AAA GC | Mutant Reverse | A | |||
| 64688 | Fluorophore-1 | CCC TTG AGC GTC ATG TCA C | Quencher-1 | WT Probe | ||
| 64689 | Fluorophore-2 | CTG ACG TTC CTC ATT TGT TCA AGG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 64685 | 0.40 uM |
| 64686 | 0.40 uM |
| 64687 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.