For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
|
|
|
>chr7:6424521+6424648 128bp ACCTTCCATTTGAACCACTG GGTTCCTCGGGTACAGGATT
Mutant= 126 bp
Wild Type = 128 bp
Sequence
Large deletion: Mutant sequence with junction in uppercase
agtgagcatcgctactttctgcttcctaactgtgcatgcaatgtgacccgatgcttcacgcccctgcagccatgtcccctccccacaccaagtgataggtcgcgcttcttcaaactgtgagtcaaaagtaaccttccatttgaaccactggcccccTGcacatatatccaatgtaccatttttctttacggattttcattttcatttcttttatttttaggtttatgtattttattttgtgcgtttgagagtttgcctgaatgtatgtatgcgtaccacatgtgtgcctggtgcccacacaggtcagaagcgggcgctgggttccctggaaggggagttacagatg
This mutation is a 7666 bp deletion beginning at Chromosome 7 position 6,427,547 bp and ending after 6,435,212 bp (GRCm39/mm39).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 64575 | ACC TTC CAT TTG AAC CAC TG | Common | A | |||
| 64576 | GGT TCC TCG GGT ACA GGA TT | Wild type Reverse | A | |||
| 64577 | GCA AAC TCT CAA ACG CAC AA | Mutant Reverse | A | |||
| 64578 | Fluorophore-1 | CTT TCT AGT GTT CAG CAA CAC ACC | Quencher-1 | WT Probe | ||
| 64579 | Fluorophore-2 | CCC TGC ACA TAT ATC CAA TGT ACC A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 64575 | 0.40 uM |
| 64576 | 0.40 uM |
| 64577 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.