For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr17:46260812-46260929 118bp CTGCTGCACTCTCCTCTCAG GTCCCCACAATCCCTGACAT
Mut= 104 bp
Wt= 118 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case):
TCAGCTACCAGACGCACTGAGGCCTTGGAGCGGGAGCTGGAAATAGGACAAGACTGCCTAGAACTGGAGTTAGGACAGAGCCGTGAGGAGCTGGACAAGTTTAAGGACAAATTCCGCAGGTGCGGAACAAGGGGCCAATCGTCTCCCATCCGTGGGAGCACCTTCCTGTCCATACGTTAGCTGAAGAGCCTCAGGTCCccctgactttatttagtaacccagatcttggaaggagagggaagttcctagactcccatgtggaggagggttggtggggcctgaggaacaggccttaaccagggctctgcctttctctgccttgttggcatgtgtaggctacagaacagctacacggcatcccagcggaccaaccaggaactggaggacaagctgcacgcactggtactgtgctgggagggtggtgtggccacaacatagcgcgggctaggacttccgggggggatgccactcaccctggggcctggggaggagagggaaggcagggcagtggtggggagggcgcggtgtgctgcgccaggcgggacagccctaatgctcacactgtctctcttctctctccgtctccctccctcatgctgccaccgctgctgctgcactctcctctcaggcctctcttagccacagctggatttttgcagttgcgtcTGAGTTTGTGTGTTTTCCCTGGTCCTGGCCTCCTTGGTCCATGTCAGGGATTGTGGGGACCCTGGCCATTTCCCTCTGCCCCTTGACCACACCCTCTCTTTTCCTGTCATGTGAGACCCAGAGTGCCTCCCTCCTGGGAAAGGGCTAGGGCTGAGGTTCTGCTCATGGCTCTGGCAGAGGCACTGAGTGATAGCCCTCAGCAGTCCCAGCCTTGGCTG
This mutation is a 468 bp deletion beginning at Chromosome 17 position 46,260,872 bp and ending after 46,261,339 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 64364 | CTG CTG CAC TCT CCT CTC AG | Wild type Forward | A | |||
| 64365 | GTC CCC ACA ATC CCT GAC AT | Common | A | |||
| 64366 | GGA GCA CCT TCC TGT CCA TA | Mutant Forward | A | |||
| 64367 | Fluorophore-1 | CTC TCT TAG CCA CAG CTG GAT T | Quencher-1 | WT Probe | ||
| 64368 | Fluorophore-2 | AGC CTC AGG TCC TGA GTT TGT GT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 64364 | 0.40 uM |
| 64365 | 0.40 uM |
| 64366 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.