For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 144 bp
Wild Type = 120 bp
>chr18:60579649-60579768 120bp AAGCTCCCTGCTCCTTCATT CACTACTCGCCAGGATCTGT
Sequence
Wt Sequence (deletions in lower case):
AAGCTCCCTGCTCCTTCATTCTGTTCCCCatcccttaggtggtaatggtcaaatcccagcctcttgctcctctgagcatccctacgtgtttatttcccccacagatcctggcgagtagtgcccgagggaaagtggctggcagagcggcgcaggcaacggtaaggaggggtccttttcccagggacagctatgggaaaggacctggctgctagggaacagctggctatcgtcctctgagagcctgctcccgtgctcaggttcccaatggcttggaggagcagaaccaccactccgagacgcacgtgttccaggggtcacctggggaccccgggatcacccatctgggagcagcggggactgggtcggtccatagtccaagcgccctggcaccaggtgagcggctgcccggcatcctgggccactgatggctctgagtctcagcaagcagcctcgattggttacacagctcaggctagacccccactcctggagacctccctgagtcctgggatccagaggctgtcttctcctcatgtgccctaatcccatctctgctctcttgattcctctccctgttctttgcctttctcttctggggtgtgggagtgggagagatggtagggggatagagcctaggcctcgcctgtcACCAATGCCATTCCATCCCCAGGCTATTCAGAGCCCCTGAAGGGCGTCCCACCGGAGAAGTTCAACCACACGGCCATCCCCAAAGGCTACCGGTGCCCTTGGCAGGAGTTCACCA
This mutation is a 619 bp deletion beginning at Chromosome 18 position 60,579,121 bp and ending after 60,579,739 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 64323 | AAG CTC CCT GCT CCT TCA TT | Common | A | |||
| 64324 | CAC TAC TCG CCA GGA TCT GT | Wild type Reverse | A | |||
| 64325 | TGG TGA ACT CCT GCC AAG G | Mutant Reverse | A | |||
| 64326 | Fluorophore-1 | AAT GGT CAA ATC CCA GCC TC | Quencher-1 | WT Probe | ||
| 64327 | Fluorophore-2 | CTG TTC CCC ACC AAT GCC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 64323 | 0.40 uM |
| 64324 | 0.40 uM |
| 64325 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.