Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
Mutant= 100 bp
Wild Type = 133 bp
>chr2:131213472+131213604 133bp CCAGGTGATGCCTTATTTTG GTCTTAGAAGGGTGCAGCAG |
Large deletion: Mutant sequence with junction in uppercase
gcccttgttctgtgatgcagagcaggcactagattatTTgagtgggagtctgctgggtggccccgatctcctcctccctgctgctgcacccttctaagac
This mutation is a 2400 bp deletion beginning at Chromosome 2 position 131,211,143 bp and ending after 131,213,542 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 64275 | CCA GGT GAT GCC TTA TTT TG | Wild type Forward | A | |||
| 64276 | GTC TTA GAA GGG TGC AGC AG | Common | A | |||
| 64277 | GCC CTT GTT CTG TGA TGC AG | Mutant Forward | A | |||
| 64278 | Fluorophore-1 | TGG CGG TCT GAT CTT GTC C | Quencher-1 | WT Probe | ||
| 64279 | Fluorophore-2 | AGG CAC TAG ATT ATT TGA GTG GGA GTC | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 64275 | 0.40 uM |
| 64276 | 0.40 uM |
| 64277 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.