Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
Mutant= 93 bp
Wild Type = 97 bp
>chr8:94136950+94137046 97bp ATGAGTGCCACGGGAACCT TGGTCGTTTAGGAGGCTTTC |
Large deletion: Mutant sequence with junction in uppercase
atgagtgccacgggaacctcacctggcttccttaacACacgtggctgctcattgctgctcactttaaggcgctgcaactgtgcctggggcttt
This mutation is a 2150 bp deletion beginning at Chromosome 8 position 94,136,987 bp and ending after 94,139,136 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 64240 | ATG AGT GCC ACG GGA ACC T | Common | A | |||
| 64241 | TGG TCG TTT AGG AGG CTT TC | Wild type Reverse | A | |||
| 64242 | Fluorophore-1 | CTA TGG CAG GGA AGC AGG T | Quencher-1 | WT Probe | ||
| 64243 | AAA GCC CCA GGC ACA GTT | Mutant Reverse | A | |||
| 64244 | Fluorophore-2 | CTT CCT TAA CAC ACG TGG CTG | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 64240 | 0.40 uM |
| 64241 | 0.40 uM |
| 64243 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.