For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 159 bp
Wild Type = 128 bp
>chr2:119027379-119027506 128bp CTGCTTTTGCCTCCCAAG CATCTGGAGCTGGAAAATGA |
Sequence
Wt Sequence (deletions in lower case):
CTGCTTTTGCCTCCCAAGATTCGGGTTTAAAGGTGTTCACCACCGCACCCAGCACAGTACCGCACCCAGCACGCTTCTGTGTTGAactaggctttactcacttgagtttcattttccagctccagatgaaaatgtttgagagccttgactcttcggctacaaagtctggccgggatctctgggctgaaatttgttcttgtctgccaagtcctgcccaagaagatgtttccgacaatgccttctcggactccttcatggactcccatcctgcaggggaaagccatacagcagcagcagactctgctgtccagccagctggaaagccgtgggctcccttgcatgattcagaagtgtatttagcatctctaggtgagttgtcaatctctgtttttctttttctgtctgtctgcctctcttccctcccccatttcctccttccctccctctactgtttttgttgacttctgctttagaccatttcatgtaaattctgtcttatttcttagcatgctgtagaaaccttctTGTTTATAAATGGTAGCCCATTTGAGTTCAAGTAAGTCAAAAATTTTTTGTACTAGGTACATGGGAGATTTCCA
This mutation is a 440 bp deletion beginning at Chromosome 2 position 119,026,982 bp and ending after 119,027,421 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 64235 | CTG CTT TTG CCT CCC AAG | Common | A | |||
| 64236 | CAT CTG GAG CTG GAA AAT GA | Wild type Reverse | A | |||
| 64237 | Fluorophore-1 | CTT CTG TGT TGA ACT AGG CTT TAC TCA | Quencher-1 | WT Probe | ||
| 64238 | TGG AAA TCT CCC ATG TAC CTA | Mutant Reverse | A | |||
| 64239 | Fluorophore-2 | CGC TTC TGT GTT GAT GTT TAT AAA TGG T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 64235 | 0.40 uM |
| 64236 | 0.40 uM |
| 64238 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.