For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr6:54534668-54534807 140bp CGTGGGGAAAACTCTGTG TGGACCTTCACATTGGTTACAG
Mutant= 159 bp
Wild Type = 140 bp
The common forward primer (63963) anneals over the nucleotide sequence containing mouse genomic variationsrs254895473, and the Mut probe (63965) anneals over the nucleotide sequence containing mouse genomic variation rs242640308.
Sequence
Wt Sequence (deletions in lower case):
GATTTCTAGCAAGTTTAGAACCTGGGGTTTTCATGTGAGGAGGAAGTTTTCTGGGGGCAACACAGGGGTGTGAGCAGAGAAGGGCAGTGCAGTGGTCAGCTCGACACCTGGCTGAGGGTGATGCCGTGGGGAAAACTCTGTGAACAGCCCAGCTTGAACAAAgcatgggggtgctcagcaaggagctccgggctgcccctggggtgtctggagtctgtatttcaggtcttttactctctgctctgtaaccaatgtgaaggtccagcgtaggtaccaaggtgggaactgaaaggtttctgacagttgatggcaccgtcttgcttgttttcttttgcagtgcacttacatctcaatcgaccaagtccccaggacccacgccatcgtgataagcagacctgcctggctctggggggcagaaatgggagccaatgaacatggggtatgcatagccaacgaagccatcaatgccagagaaccagctgctgagacggaagccttactgggaatggatctggtcaggtacagaatggtgactcttcgaaacaattgccaatgggagtggggattaatgttttcctgtacttctggtgtaagaagttctattttgtggaattctaagatgatgggggaaaaTAGGTAGATGGTAATGGAATATTATTTGCCAATAAAAAAAGGATTAAATACTGCTGTGTGTTACAAATTGGATCTCGAGAACTTGATAAAACCTAAGTGAAAGACACAGATACAAAAGCCATTTGTGTGAATCACCGAAGTTATAGAGGCAGAAAGTAGAGGGATGCTTCTGCGGGGTTGG
This mutation is a 471 bp deletion beginning at Chromosome 6 position 54,511,284 bp and ending after 54,511,754 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 63963 | CGT GGG GAA AAC TCT GTG | Common | A | |||
| 63964 | TGG ACC TTC ACA TTG GTT ACA G | Wild type Reverse | A | |||
| 63965 | TGG CTT TTG TAT CTG TGT CTT TC | Mutant Reverse | A | |||
| 63966 | Fluorophore-1 | CTC AGC AAG GAG CTC CGG | Quencher-1 | WT Probe | ||
| 63967 | Fluorophore-2 | CCA GCT TGA ACA AAT AGG TAG ATG GTA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 63963 | 0.40 uM |
| 63964 | 0.40 uM |
| 63965 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.