Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr1:51834529-51834638 110bp GCTTTGAAGCAAATCACAGAG TCCGACAAAGCAAAGCTACA
Mutant= 82 bp
Wild Type = 110 bp
Wt Sequence : gctttgaagcaaatcacagaggctcttagaAtacccaggggtacccgatgaacatatattaaccagctgaatcctcccacatttttttcttgtagCTTTGCTTTGTCGGA
Large deletion: gctttgaagcaaatcacagaggctcttagaATctggaaggagatgctgttgcaaggcagcaggaaaggagccaggtagccct
A 190 bp deletion beginning at Chromosome 1 position 51,834,418 bp and ending after 51,834,607 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 63700 | GCT TTG AAG CAA ATC ACA GAG | Common | A | |||
| 63701 | TCC GAC AAA GCA AAG CTA CA | Wild type Reverse | A | |||
| 63702 | AGG GCT ACC TGG CTC CTT T | Mutant Reverse | A | |||
| 63703 | Fluorophore-1 | AAG GAG ATG CTG TTG CAA GG | Quencher-1 | MUT Probe | ||
| 63704 | Fluorophore-2 | ACC AGC TGA ATC CTC CCA C | Quencher-2 | WT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 63700 | 0.40 uM |
| 63701 | 0.40 uM |
| 63702 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.