For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:16952875+16952954 80bp GGACCAGCAGGTTTGTGACT TTAAAAGTCTCTATGTGAACTGATGC
Mutant= 113 bp
Wild Type = 80 bp
The common forward primer (primer 63690) anneals over the nucleotide sequence containing mouse genomic variations rs265192899 and rs231322384.
Sequence
Wt Sequence ggaccagcaggtttgtgactctgttagcTcgaaggtgaggaaaccaatggtaaagcatcagttcacatagagacttttaa
MUT Sequence:
ggaccagcaggtttgtgactctgttagcTCttggggtagaagctctcagattaagattttcatttttttttcctacatacctgagattagtctcaaagactgggaatgtgtgg
A 602 bp deletion beginning at Chromosome 7 position 6,389,393 bp and ending after 6,389,994 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 63690 | GGA CCA GCA GGT TTG TGA CT | Common | A | |||
| 63691 | CCA CAC ATT CCC AGT CTT TG | Mutant Reverse | A | |||
| 63692 | TTA AAA GTC TCT ATG TGA ACT GAT GC | Wild type Reverse | A | |||
| 63693 | Fluorophore-1 | TTA GCT CGA AGG TGA GGA AAC | Quencher-1 | WT Probe | ||
| 63694 | Fluorophore-2 | CAT ACC TGA GAT TAG TCT CAA AGA CTG G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 63690 | 0.40 uM |
| 63691 | 0.40 uM |
| 63692 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.