For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 86 bp
Wild Type = 93 bp
>chr4:119437246+119437338 93bp GCCTTGGTGAGTGGAACTG CCTCTTCCACAAAGGGTGTC |
Sequence
Wt Sequence (deletions in lower case):
TATCTGTTCCTGGACCTTGGCCTCACTGTCCCAAGTTTGCATTTTTATCCACTACACCCctggagctcatatgcacctagtacaggcagggtcgccaagtcccttcagccagacattggctttacctgcgcttccaccttgccctttgcctgggctcagagcgcccattctgccttccacagaagcacttgattgaattctgctacactgttgcccagaaatatcttttcgaaggaagacacgaagatgccgtccctgcagctttgcactcccttcgcttccgcatgaacgtgcacggcctgagctcagtcgagctcgttcctgcttacctgctcctggctgaggccagccttggtgagtggaactgacctgagacccccagagcccattgaagtgctgtattgatccttgtcaGGGGCAAGACACCCTTTGTGGAAGAGG
This mutation is a 355 bp deletion beginning at Chromosome 4 position 119,436,957 bp and ending after 119,437,311 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 63671 | GCC TTG GTG AGT GGA ACT G | Wild type Forward | A | |||
| 63672 | CCT CTT CCA CAA AGG GTG TC | Common | A | |||
| 63675 | TAT CTG TTC CTG GAC CTT GG | Mutant Forward | A | |||
| 63676 | Fluorophore-1 | TGA AGT GCT GTA TTG ATC CTT GTC | Quencher-1 | WT Probe | ||
| 63677 | Fluorophore-2 | CCT CAC TGT CCC AAG TTT GCA T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 63671 | 0.40 uM |
| 63672 | 0.40 uM |
| 63675 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.