For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 106 bp
Wild Type = 107 bp
>chr16:5008269+5008375 107bp GGTCCTGCTGGATGACAGTAA ACGAGTGCATTGCGGTGA |
Sequence
Wt Sequence (deletions in lower case):
ACAGAGCAGAAGGCTGAGGAAAACAGGGGGGTCAAGGGTCATCTCAGGGTAGGCTTAGACTGTGTACGGCcagaaagaggcctggactgaggtggccctttggggggtgtggggcaggtggctgagatggggctttctgatgaggagctgaggcaggagctgcaggccactgcagaggaagtactggggaggctgaggagccggcagctcttccagtcggaatgggacgtcgctgcctttgtggtctttctcacatttgtgggtgagtgcggctcctgatccaaggccctaccccgttgaagcagggggccacatcacatctggatgcctctctctggtctccaggcactgtgctgttgttgctgttgctggtctttgtccattgctgctgttgttgctgctgcaacacctcccccaggccccggaaggtgagccccgggaaggtgagagcctgggaagatgaacctaggaaggggtgggcgctgcgcagagaggagctcccctcgaagcccccctcacacctacgctgggcgagaagggcagggcagagccttctggtgagggttttttctcttgcaggaaaagcgcaatggtgtggataacttggccctggaaccttaatgctaacttgcccttggcatgggtcctgctggatgacagtaacagagccaatgtttgccaaagcccgagtctggactgtgttctaatcccgcCAGGGGCAGTGTAGTGCCTCACCGCAATGCACTCGT
This mutation is a a 643 bp deletion beginning at Chromosome 16 position 5,007,697 bp and ending after 5,008,339 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 63634 | ACG AGT GCA TTG CGG TGA | Common | A | |||
| 63635 | GGT CCT GCT GGA TGA CAG TAA | Wild type Forward | A | |||
| 63636 | ACA GAG CAG AAG GCT GAG GA | Mutant Forward | A | |||
| 63637 | Fluorophore-1 | ACT GTG TTC TAA TCC CGC CA | Quencher-1 | WT Probe | ||
| 63638 | Fluorophore-2 | TTA GAC TGT GTA CGG CCA GGG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 63634 | 0.40 uM |
| 63635 | 0.40 uM |
| 63636 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.