Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
Mutant= 129 bp
Wild Type = 129 bp
>chr1:92642119-92642247 129bp CCCATCTTCTAGCCAATCCA ACACCGCACAGCACGAGTT |
Large deletion: Mutant sequence with junction in uppercase
cccatcttctagccaatccattactgcctgcgaatcctaaacagtagcCTctttatcagagctgctgctagtacaagaccccaggtcagaggactccgggtgccccgggtggagactctgaaggaggtg
This mutation is a 5306 bp deletion beginning at Chromosome 1 position 92,636,893 bp and ending after 92,642,198 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 63604 | CCC ATC TTC TAG CCA ATC CA | Common | A | |||
| 63605 | ACA CCG CAC AGC ACG AGT T | Wild type Reverse | A | |||
| 63606 | CAC CTC CTT CAG AGT CTC CA | Mutant Reverse | A | |||
| 63607 | Fluorophore-1 | AAC AGT AGC CAT TCG GAT GGT T | Quencher-1 | WT Probe | ||
| 63608 | Fluorophore-2 | CAG TAG CCT CTT TAT CAG AGC TGC TG | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 63604 | 0.40 uM |
| 63605 | 0.40 uM |
| 63606 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.