For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 120 bp
Wild Type = 119 bp
>chr9:55488857-55488975 119bp CAACTTGCGTTTGTGTAACTCAC CAGGTGACTTGATCTCAATGATGT
Sequence
Wt Sequence (deletions in lower case):
CCCGAGATACATGTGAAGTGTAAAATGTTTGAATTAAAATTTATGCAGAAGCTAACCcccttttaaaggggtttagaagataccgctgttgatcattatatcagtcaacttgcgtttgtgtaactcactgctttttttttttttttttaagaaccttctgcccagagtagctgccaaacttaatgttgctccagtttctgacatcattgagatcaagtcacctgacacatttgtgagaactatctatgcaggtaagttctaaggaagataatcaacatgttaatttttacagtatacataaatcttagaaataggattaggaaacaaacctacgattaaatggaccatcttaaaggtttctgaaaaatgctttaattgagaatagctactgtccaatttattatgtgcacagtgcttttatactgccttacagtttatggagtgagatctttccctccagtggctaataaaaattaagtttgccATCCAATATATATGTATTTTAAATGTTTAATTGTGATGTAATTATATCACTCCTCCCTCCAAC
This mutation is a 427 bp deletion beginning at Chromosome 9 position 55,488,597 bp and ending after 55,489,023 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 63556 | CAA CTT GCG TTT GTG TAA CTC AC | Wild type Forward | A | |||
| 63557 | CAG GTG ACT TGA TCT CAA TGA TGT | Wild type Reverse | A | |||
| 63558 | CCC GAG ATA CAT GTG AAG TGT AA | Mutant Forward | A | |||
| 63559 | GTT GGA GGG AGG AGT GAT ATA AT | Mutant Reverse | A | |||
| 63560 | Fluorophore-1 | TAG CTG CCA AAC TTA ATG TTG CT | Quencher-1 | WT Probe | ||
| 63561 | Fluorophore-2 | TGC AGA AGC TAA CCA TCC AAT ATA TAT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 63556 | 0.40 uM |
| 63557 | 0.40 uM |
| 63558 | 0.40 uM |
| 63559 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.